Home New Customer? Create Account
Member Login:

High Copy Origins

OG1140 - pSF-CMV-Puro-COOH-3C-6His; 5ug

PRICE

Starting at: $357.00

Please Choose:

Shipping Option



Enter Quantity:
mammalian6c image38 copy


This plasmid is compatible with all of the other DNA sequences available on this site which are all sold in the same backbone. This flexibility allows you to create any vector you require with a variety of functions simply by compiling the relevant sections from our product range.

Product Name: pSF-CMV-Puro-COOH-3C-6His

Product Code: OG1140

Size (bp): 6192

Bacterial Antibiotic Selection: KanR

Origin and Compatibility: pUC high copy derived from pBR322

Bacterial Copy Number: 500-700 per cell

Promoter: Cytomegalovirus (CMV) immediate early promoter

Promoter Expression Level: This plasmid contains the mammalian CMV promoter to drive gene expression. We have tested all of our mammalian promoters in a range of cell types and CMV is consistently the strongest in those we have studied. However there are many reports of the CMV promoter demonstrating silencing by methylation in long-term culture. For this reason we stock a range of other promoters that are compatible with this plasmid and are available on request.

Plasmid Purpose:

This plasmid is designed to express tagged proteins in mammalian cells either by transient transfection or by creating stable cell lines. It contains a puromycin resistance expression cassette using the human Ubiquitin promoter to drive expression and allow for the selection of cells containing the plasmid.

About the Peptide Tag:

This plasmid contains a c-terminal Hexa-Histidine (6His) affinity tag that can be fused to a gene of interest to allow protein detection and/or purification. The sequence of the tag is: HHHHHH

For more information on the methods that can be used to purify proteins please see our protein tag guide.

About the Cleavage Tag:

This plasmid also encodes a protease cleavage site that is designed to be positioned between your gene of interest and the tag to allow the removal of the tag following protein purification or isolation. This plasmid contains a 3C cleavage tag. The protein sequence of the cleavage tag is: LEVLFQ?GP. Human Rhinovirus (HRV) 3C Protease is a highly specific protease that cleaves between the Glu and Gly residues of its recognition site. It is often produced with the trademname 'PreScission protease'.

For more information on which cleavage tag to use see our cleavage tag guide.

Making Protein Fusions:

This plasmid has been designed to allow three types of cloning into the main MCS to join a coding sequence with the tag.

SnapFusion Cloning:

If you would like to fuse your coding sequence to the tag with minimal additional bases you can use our SnapFusion technology. This process involves amplifying your gene by PCR to add specific restriction sites onto the ends. When these sites are cut they produce an overhang that is compatible with this plasmid cut with BseRI or BsgI.

To insert your gene:
1: Amplify your gene with primers designed using this spreadsheet 
2: Cut the plasmid with either BseRI or BsgI.*
3: Cut your gene with the enzyme you added using the spreadsheet (any of AcuI BpmI BpuEI BseRI BsgI EciI).
4: Clone the gene into the plasmid using DNA ligase.

Using this method with an N-terminal tag plasmid will result in the tag coding sequence immediately followed by your genes ATG start codon at the join. This results in a seamless fusion of the two sequences with no extra bases being added. Using this method on C-terminal tag plasmids will convert your genes stop codon into a TAC (Tyr Y) codon followed by the plasmid tag coding sequence. This results in no extra bases between your gene and the tag. See the diagram below for more information.

*Please note that insect expression plasmids cannot be cut with BsgI only BseRI because of unavoidable conflicting sites in the backbone. Also Yeast plasmids can only be cut with BseRI not BsgI because of conflicting sites in the backbone.

Using this technique will create a gene fragment that can be ligated into any or our >1500 peptide and reporter tag plasmids. If you use one of the other techniques below (Gibson InFusion Seamless or LIC) you will need new primers for every vector you clone into because the arms of homology will change according to the tag plasmid you are cloning into.

If you find that your gene sequence has sites in it that make using this cloning strategy difficult you can still use one of the alternative methods below (e.g. standard cloning or Gibson cloning).

Download this worksheet to help you design primers for cloning your gene in our SnapFusion technique.

Standard Enzymes:

If you are not concerned about leaving a few extra bases between the tag coding sequence and your gene you can clone your gene into the vector using standard cloning restriction enzymes. This strategy will require you to choose which enzymes you want to use to clone your gene.

Download this worksheet which provides primers with different enzyme choices positioning your gene as close to the tag as possible in each case. Please note that standard enzymes will always leave additional nucleotides between your gene and the tag but using the spreadsheet will ensure the tag and gene are in frame.

Gibson cloning/InfusionHD/GeneArt Seamless/Ligase Independent Cloning (LIC) Methods:

These cloning techniques use reagents sold by other companies and allow you to fuse sequences together using enzymes that chew back the DNA to leave overlapping ends/overhangs. The subsequent method of joining the DNA depends on the kit used. To use one of these techniques you can either design your own primers or you can use the spreadsheet below to help with the design.

Download this worksheet to help you design primers for cloning your gene using Gibson assembly InfusionHD GeneArt Seamless cloning or Ligase Independent Cloning (LIC) techniques.

Sequencing Primers:

These primers can be used to sequence a number of regions in this plasmid. There are 10 forward and 10 reverse primers that are designed to flank key restriction sites and positions in the plasmid:

OXGP-F1: TCGTTGCGTTACACACAC Sequences towards the Bgl2 site clockwise
OXGP-R1: TGTGTCGAGTGGATGGTAG Sequences towards the Bgl2 site anti-clockwise
OXGP-F2: TGTCGATCCTACCATCCA Sequences towards the MCS (NotI) clockwise
OXGP-R2: AGTCAGTCAGTGCAGGAG This primer does not bind C-terminal tag plasmids and should not be used.
OXGP-F3: AGTTGTCTCCTCCTGCACT This primer does not bind C-terminal tag plasmids and should not be used. 
OXGP-R3: AGCTGAAGGTACGCTGTATC Sequences towards the MCS (NheI) anti-clockwise
OXGP-F4: TCCTTAAGGTCGTCAGC Sequences towards the SbfI site clockwise
OXGP-R4: GATGAACTACTTCTGACCCC Sequences towards the SbfI site anti-clockwise
OXGP-F5: CTCATTGGTTACCTTGGG Sequences towards the PacI site clockwise
OXGP-R5: ACAAGTCGATCTCGCCAA Sequences towards the PacI site anti-clockwise
OXGP-F6: TGGTCCTTGCTATTGCAC Sequences towards the SwaI site clockwise
OXGP-R6: CAAGATGGATCGGACGAA Sequences towards the SwaI site anti-clockwise
OXGP-F7: GATCCATCTTGCAGGCTAC Sequences towards the FseI site clockwise 
OXGP-R7: GGAGTAATACCTGGCGATAG Sequences towards the FseI site anti-clockwise 
OXGP-F8: TCCCGATCTATCCGAGAT Sequences towards the AscI site clockwise 
OXGP-R8: ATCGTCGAGACTCGCAC Sequences towards the AscI site anti-clockwise 
OXGP-F9: CAGGAAGTCCAATCGTCAG Sequences towards the PmeI site clockwise 
OXGP-R9: CTCGAAACGACGGAGATT Sequences towards the PmeI site anti-clockwise 
OXGP-F10: GAATCTCGTCAGCTATCGTC Sequences towards the AsiSI site clockwise 
OXGP-R10: CCTGTGGAGCTAATGGTC Sequences towards the AsiSI site anti-clockwise 

Download this datasheet for more information on sequencing primers

Transcription Termination:This plasmid contains three alternative transcription terminators for mammalian bacterial and bacteriophage (T7) expression. This means that only the promoter needs to be changed to alter the expression system you are using. We sell multiple promoters that can be used in each of these systems. The presence of each terminator does not reduce expression in the alternative systems.

Genetic Modifications to standard parts:

  • CMV promoter ? an NcoI site has been ablated in the CMV promoter. This change does not reduce expression.
  • KanR cassette ? This KanR resistance region is not a wild type sequence it has been modified to remove all restriction sites that conflict with the SnapFast system and to retain a high level of antibiotic resistance. It has been validated in E.coli.
  • The Puromycin gene has been modified to remove a StuI site and an EagI site to ensure compatibility with all of our products. These are all conservative changes and do not change the amino acid sequence.
  • The Ubiquitin (Ub) promoter in this plasmid has been modified to remove BseRI StuI and SpeI sites. These changes do not reduce expression.